View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2643R-Insertion-4 (Length: 341)
Name: NF2643R-Insertion-4
Description: NF2643R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2643R-Insertion-4 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 9 - 341
Target Start/End: Original strand, 26477007 - 26477343
Alignment:
| Q |
9 |
gcgcaatgtgtgagtgatctactagtag-----ta--ggaggctatggtgtttaaaacaacaaaaatttataatcttggcaatctatgcttttattattt |
101 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26477007 |
gcgcaatgtgtgagtgatctactagtatcctcctactggaggctatggtgtttaaaacaacaaaaatttataatcttggcaatctatgcttttattattt |
26477106 |
T |
 |
| Q |
102 |
cttcgacagaacgcaatctaaggttttattctttcagttgtttttcatttctatatctttcccatcacgtggatttcttcactcatttcacaattatata |
201 |
Q |
| |
|
||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26477107 |
ctttgacagaacgcaatctaagattttattctttcagttgtttttcatttctatatctttcacatcacgtggatttcttcactcatttcacaattatata |
26477206 |
T |
 |
| Q |
202 |
atcttttccatattattaataaaccgtgcttagaactttcaccataacaactcaaaccacttgannnnnnnnnnnnnnaaaatattgttatacttttctt |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26477207 |
atcttttccatattattaataaaccgtgcttagaactttcaccat---aactcaaaccacttgatttttatttttttttaaatattgttatacttttctt |
26477303 |
T |
 |
| Q |
302 |
tggcacgaagaaacgaaacggttctttcttatatacacac |
341 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
26477304 |
tggcatgaagaaacgaaacggttctttcttatatatacac |
26477343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University