View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2643_high_16 (Length: 238)
Name: NF2643_high_16
Description: NF2643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2643_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 39305332 - 39305106
Alignment:
| Q |
1 |
tcattggccatcataagtacgtttagtgattctgtttgaatattggcatatgattgaatttggacttgttgtgcatattcac---tcagtgcaacttttg |
97 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | ||||||||||||| |
|
|
| T |
39305332 |
tcattggccatcataagtacgttgagtgattctgtttgaatattggcatatgattgaatttagacttgttgtgcatattcactaattagtgcaacttttg |
39305233 |
T |
 |
| Q |
98 |
tgcaatttatcattttccttgtcaatattacacga----caatgacaaacaaaagcttcaagatcattttattttgaaaagtggcnnnnnnncattacat |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39305232 |
tgcaatttatcattttccttgtcaatattacacgacaatcaatgacaaacaaaagcttcaagatcattttattttgaaaagtggc-aaaaaacattacat |
39305134 |
T |
 |
| Q |
194 |
taattgtatgtgtatatatactcttata |
221 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
39305133 |
taattgtatgtgtatatatactcttata |
39305106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University