View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2643_low_10 (Length: 317)
Name: NF2643_low_10
Description: NF2643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2643_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 8e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 1 - 154
Target Start/End: Complemental strand, 46338059 - 46337912
Alignment:
| Q |
1 |
tgttcgtgtattttgtttatttttaagtagtctaatatatataaa-ttcactccacaagtgaataccagtggaatatgcgttcaaacttcgacccttaca |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
46338059 |
tgttcgtgtattttgtttatttttaagtagtctaatatatataaaattcactccacaagtgaatactagtggaatatgccttcaaacttcgacccttaca |
46337960 |
T |
 |
| Q |
100 |
tattacatgtaatgtctctatcaattaagttatgttcacggtgagggcatccttg |
154 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
46337959 |
ta-------taatgtctctatcaattaagttatgttcacggtgacggcatccttg |
46337912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 236 - 299
Target Start/End: Complemental strand, 46337830 - 46337767
Alignment:
| Q |
236 |
aaaatgtcaatcaaatgaatcaaaccagaccaatgtattcttcattgattcctttggattcgat |
299 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46337830 |
aaaatgtcaatcaaataaatcaaaccagaccaatgtattcttcattgattcctttggtttcgat |
46337767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 99 - 135
Target Start/End: Original strand, 11948272 - 11948308
Alignment:
| Q |
99 |
atattacatgtaatgtctctatcaattaagttatgtt |
135 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11948272 |
atattacatgtaatgtctctatcaattcagttatgtt |
11948308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University