View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2643_low_14 (Length: 251)
Name: NF2643_low_14
Description: NF2643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2643_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 189
Target Start/End: Original strand, 51231540 - 51231728
Alignment:
| Q |
1 |
attatttcatgttgaagtggttcatattgtttgattttattaaaaccaaatctatattttttatttgtaaaagattatcttcgatgtaattaattgacca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51231540 |
attatttcatgttgaagtggttcatattgtttgattttattaaaacctaatctatattttttatttgtaaaagattatcttcgatgtaattaattgacca |
51231639 |
T |
|
| Q |
101 |
gtgaaaaacattgatcacatgtacggtttatgcagtaaattattataattagtgtgttataatttacttaaaaaatttattttgtgaaa |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51231640 |
gtgaaaaacattgatcacatgtacggtttatgcagtaaattattataattagtgtgttataatttacttaaaaaatttattttgtgaaa |
51231728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 209 - 245
Target Start/End: Original strand, 51231758 - 51231794
Alignment:
| Q |
209 |
aaaaaactcgatgtacattgtcttccattcatctcac |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51231758 |
aaaaaactcgatgtacattgtcttccattcatctcac |
51231794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University