View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2643_low_15 (Length: 249)
Name: NF2643_low_15
Description: NF2643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2643_low_15 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 55 - 249
Target Start/End: Complemental strand, 40053676 - 40053474
Alignment:
| Q |
55 |
gggggtactaagagggacttagttgatagatttgaaactttgtttcacttacttctttatnnnnnnnnnnnnnggcaatactaatgtatacttaggaaca |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40053676 |
gggggtactaagagggacttagttgatagatttgaaactttgtttcacttacttctttataagaaagaaaaaaggcaatactaatgtatacttaggaaca |
40053577 |
T |
 |
| Q |
155 |
aacataacttgaaaattatcacgcagaattatgaatagattttaggcaaaatttatgttgctagaaa--------caaggacgctatgtagccaattttt |
246 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40053576 |
aacataacttcaaaattatcacgcagtcttaggaatagattttaggcaaaatttatgttgctagaaacaagcaaacaaggacgctatgtagccaattttt |
40053477 |
T |
 |
| Q |
247 |
ctt |
249 |
Q |
| |
|
||| |
|
|
| T |
40053476 |
ctt |
40053474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University