View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2643_low_19 (Length: 237)
Name: NF2643_low_19
Description: NF2643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2643_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 13 - 219
Target Start/End: Original strand, 12833241 - 12833447
Alignment:
| Q |
13 |
aaaataaaaattagcgtaaacttagcgggaaaatgtgaaatcccaccacaccacacacccactttattgtgcttagataattctacttcataattatgac |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |||||| ||||||||||||||||||||||| |
|
|
| T |
12833241 |
aaaataaaaattagcgtaaacttagcgggaaaacgtgaaatcccaccacaccacacacccactttcttgcgcttaggtaattctacttcataattatgac |
12833340 |
T |
 |
| Q |
113 |
catcctgggacctttccacactcttcttctttttctttgatgaagagataacacccgcatccccatgatgttgatcagataaccattctaaactccatgg |
212 |
Q |
| |
|
|||||| | |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12833341 |
catcctcgcacctttccacactcttcttcattttctttgatgaagagataacacccgcatccccatgatgttgattagataaccattctaaactccatgg |
12833440 |
T |
 |
| Q |
213 |
accagac |
219 |
Q |
| |
|
||||||| |
|
|
| T |
12833441 |
accagac |
12833447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 189
Target Start/End: Complemental strand, 10619028 - 10618990
Alignment:
| Q |
151 |
gatgaagagataacacccgcatccccatgatgttgatca |
189 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
10619028 |
gatgaagagataacgcctgcatccccatgatgttgatca |
10618990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University