View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2644_low_4 (Length: 227)
Name: NF2644_low_4
Description: NF2644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2644_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 4 - 211
Target Start/End: Complemental strand, 33737464 - 33737268
Alignment:
| Q |
4 |
catagggaaaagttatgtaactttgagtcaatatccaccattggatgaatcttatggcccatattttgacaaatgtttcaaccnnnnnnnnnnnnnnnnn |
103 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
33737464 |
catagggaaaagttatgtaactttgagttaatatccaccattggatgaatcttatggctcatattttgacacgtgtttcaaccatttttttt-------- |
33737373 |
T |
|
| Q |
104 |
nnnatcacagttagattgaaacccatttcacaaaatcaatacttgttttgcaatcactgggcacaaccatcatcccttccacgaaccaccaccttcagtc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33737372 |
---atcacagttagattgaaacccatttcacaaaatcaatacttattttgcaatcactgggcacaaccatcatcccttccacgaaccaccctcttcagtc |
33737276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 9 - 49
Target Start/End: Complemental strand, 19239566 - 19239526
Alignment:
| Q |
9 |
ggaaaagttatgtaactttgagtcaatatccaccattggat |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19239566 |
ggaaaagttatgtaactttgagtcaatatccatcattggat |
19239526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 74
Target Start/End: Original strand, 19238766 - 19238832
Alignment:
| Q |
7 |
agggaaaagttatgtaactttgagtcaatatccaccattggatgaatcttatggcccatattttgaca |
74 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| || ||||| |||| ||||| ||| ||||||||| |
|
|
| T |
19238766 |
agggaaaa-ttatgtaactttgagtcaatatccatcactggataaatcctatggtccaaattttgaca |
19238832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 85
Target Start/End: Original strand, 29439397 - 29439473
Alignment:
| Q |
8 |
gggaaaagttatgtaactttgagtcaatatccaccattggatgaatcttatggcccatattttgacaaatgtttcaac |
85 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||| | ||||| ||| || ||||||||| |||||||||| |
|
|
| T |
29439397 |
gggaaaagttatgtgactttgt-tcaatatccaccattggtttaatctcttggttcagattttgacacatgtttcaac |
29439473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 47
Target Start/End: Original strand, 5430961 - 5431000
Alignment:
| Q |
7 |
agggaaaagttatgtaactttgagtcaatatccaccattgg |
47 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
5430961 |
agggaaaagttatgtgacttt-agtcaatatccaccattgg |
5431000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University