View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2645_high_4 (Length: 239)
Name: NF2645_high_4
Description: NF2645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2645_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 43917647 - 43917426
Alignment:
| Q |
1 |
ttttagaacacgtctggaatataaatttggatgcgttttcagccgaaactcaacgaaagaaaagcaaactctttttcttttgtttaacagaaattcgtgc |
100 |
Q |
| |
|
|||||||||||| |||||||| |||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
43917647 |
ttttagaacacggctggaatagaaattttgatgcgttttcagccgaaactcaaccaaagaaaagcaaactctttttcttctgtttaacagaaattcatgc |
43917548 |
T |
|
| Q |
101 |
aacaaggttacactgtgtttgattggaagtttcctcttttcctcgccttgtagacgatgcttggccttaacctttctgaatgctccgtgttaaaagatga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43917547 |
aacaaggttacactgtgtttgattggaagtttcgtcttttcctcaccttgtagacgatgcttggccttaacctttctgaatgctccgtgttaaaagatga |
43917448 |
T |
|
| Q |
201 |
tcctgggtttgatctatcttta |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
43917447 |
tcctgggtttgatctatcttta |
43917426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University