View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2646_high_16 (Length: 240)

Name: NF2646_high_16
Description: NF2646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2646_high_16
NF2646_high_16
[»] chr5 (1 HSPs)
chr5 (28-236)||(37975677-37975886)


Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 28 - 236
Target Start/End: Complemental strand, 37975886 - 37975677
Alignment:
28 ccataacaccacaagtcacaacatcatagcaaaatcaa--gtcttttggagctgcaagttagtaacaacattaaaatataaatttgtgaaattttggatc 125  Q
    ||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37975886 ccataacaccacaagtcacaacatcatagcaaaatcaatagtcttttggagctgcaagttagtaacaacattaaaatataaatttgtgaaattttggatc 37975787  T
126 aaatattgtaaaccatcccacaatcccgtcatctctcatacttgtctcgccttagcatatcccaagaacaagtatcaatcgttctcatagctagtttgtt 225  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37975786 aaatattgtaaaccatcc-acaatcccgtcatctctcatacttgtctcgccttagcatatcccaagaacaagtatcaatcgttctcatagctagtttgtt 37975688  T
226 taacattgcca 236  Q
    |||||||||||    
37975687 taacattgcca 37975677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University