View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2646_high_17 (Length: 227)
Name: NF2646_high_17
Description: NF2646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2646_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 58 - 208
Target Start/End: Complemental strand, 10456078 - 10455927
Alignment:
| Q |
58 |
actatttcatttctttatttaacagttcattattaaactttattaaaagaactgtannnnnnn-ggtaaagattagatttttatgggaatgttcaatgca |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10456078 |
actatttcatttctttatttaacagttcataattaaactttattaaaagaactgtattttttttggtaaagattagatttttatgggaatgttcaatgca |
10455979 |
T |
 |
| Q |
157 |
tttaagttgaatgagaaattgacagtaaccatccactgttttatcacatagg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10455978 |
tttaagttgaatgagaaattgacagtaaccatccactgttttatcacatagg |
10455927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 14 - 45
Target Start/End: Complemental strand, 10456125 - 10456094
Alignment:
| Q |
14 |
catcatcactagtcaaaggtatttcgttttca |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10456125 |
catcatcactagtcaaaggtatttcgttttca |
10456094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University