View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2646_high_18 (Length: 226)
Name: NF2646_high_18
Description: NF2646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2646_high_18 |
 | |
|
| [»] scaffold0184 (1 HSPs) |
| | |
|
| [»] scaffold0078 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0184 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: scaffold0184
Description:
Target: scaffold0184; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 9 - 224
Target Start/End: Complemental strand, 14793 - 14578
Alignment:
| Q |
9 |
tttttgtggtgaagttgtcattgtattgcatggttgaaatttgacatagacaaggtcaacgtgtaatgagggacaaaatgcttgtcaaagaaaaatgaca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14793 |
tttttgtggtgaagttgtcattgtattgcatggttgaaatttgacatagacaagttcaacgtgtaatgagggacaaaatgcttgtcaaagaaaaatgaca |
14694 |
T |
|
| Q |
109 |
atggaaaattctttctccttgtgatagcactactttgattacggttttaaattgcgatctgcaactacaattgtgaaggtagtatcattgttttaatggt |
208 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14693 |
atggaaaattcttcctccttgtgatagcactactttgattacggttctaaattgcgatctgcaactacaattgtgaaggtagtatcattgttttaatggt |
14594 |
T |
|
| Q |
209 |
cttgatggtattgaaa |
224 |
Q |
| |
|
||||| |||||||||| |
|
|
| T |
14593 |
cttgacggtattgaaa |
14578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 9 - 224
Target Start/End: Original strand, 58051 - 58266
Alignment:
| Q |
9 |
tttttgtggtgaagttgtcattgtattgcatggttgaaatttgacatagacaaggtcaacgtgtaatgagggacaaaatgcttgtcaaagaaaaatgaca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
58051 |
tttttgtggtgaagttgtcattgtattgcatggttgaaatttgacatagacaagttcaacgtgtaatgagggacaaaatgcttgtcaaagaaaaatgaca |
58150 |
T |
|
| Q |
109 |
atggaaaattctttctccttgtgatagcactactttgattacggttttaaattgcgatctgcaactacaattgtgaaggtagtatcattgttttaatggt |
208 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
58151 |
atggaaaattcttcctccttgtgatagcactactttgattacggttctaaattgcgatctgcaactacaattgtgaaggtagtatcattgttttaatggt |
58250 |
T |
|
| Q |
209 |
cttgatggtattgaaa |
224 |
Q |
| |
|
||||| |||||||||| |
|
|
| T |
58251 |
cttgacggtattgaaa |
58266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 148 - 181
Target Start/End: Complemental strand, 30532276 - 30532243
Alignment:
| Q |
148 |
tacggttttaaattgcgatctgcaactacaattg |
181 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
30532276 |
tacggttttaaattgcgatctgcaacaacaattg |
30532243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University