View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2646_high_5 (Length: 435)
Name: NF2646_high_5
Description: NF2646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2646_high_5 |
 |  |
|
| [»] chr2 (10 HSPs) |
 |  |
|
| [»] chr5 (5 HSPs) |
 |  |
|
| [»] scaffold0306 (1 HSPs) |
 |  |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
| [»] scaffold0152 (1 HSPs) |
 |  |  |
|
| [»] scaffold0171 (1 HSPs) |
 |  |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
| [»] scaffold0361 (1 HSPs) |
 |  |  |
|
| [»] scaffold0053 (1 HSPs) |
 |  |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |  |
|
| [»] scaffold0066 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 400; Significance: 0; HSPs: 10)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 400; E-Value: 0
Query Start/End: Original strand, 8 - 435
Target Start/End: Original strand, 33519366 - 33519793
Alignment:
| Q |
8 |
agtgagatgaattaaaagaaaatggctatatcgttctttcttagtaactttttccgctcttctgatggcaaggttactagatcccctagtttttggcgag |
107 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33519366 |
agtgacatgaattaaaagaaaatggctctatcgttctttcttagtaactttttccgctcttctgatggcaaggttactagatcccctagtttttggcgag |
33519465 |
T |
 |
| Q |
108 |
taccctgctgatatgcgctctattcttgggagccagttgcctaggttctcatctaaggagaagagcctcctaagaggcagcctggacttcattggcatca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33519466 |
taccctgctgatatgcgctctattcttgggagccagttgcctaggttctcatctaaggagaagagcctcctaagaggcagcctggacttcattggcatca |
33519565 |
T |
 |
| Q |
208 |
ataactacggggctctctatgccaaggaatgctacctctcaacttgccctctcgaagcagctcgtccaataaaaggctttttgcaaacaacaggaatgag |
307 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
33519566 |
ataactacggggctctctatgccaaggattgctacctctctacttgccctctcgaagcagctcgtccaataaaaggctttttgcaaacaactgggatgag |
33519665 |
T |
 |
| Q |
308 |
agatggcattccaattggtgatcaggtactcatatgtagtccaactgttcttgtcattgtgttatatggtctatgaagcacggatacggacaccggacac |
407 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33519666 |
agatggcattccaattggtgatcaggtactcatatgtagtccaactgtttttgtcattgtgttatatggtctatgaagcacggatacggacaccggacac |
33519765 |
T |
 |
| Q |
408 |
gacgcggatactgacacaccgacaccgc |
435 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
33519766 |
gacgcggatactgacacaccgacaccgc |
33519793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 77 - 377
Target Start/End: Complemental strand, 33496521 - 33496221
Alignment:
| Q |
77 |
aaggttactagatcccctagtttttggcgagtaccctgctgatatgcgctctattcttgggagccagttgcctaggttctcatctaaggagaagagcctc |
176 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| || |||||| | | |||| | ||||||||||| ||| |
|
|
| T |
33496521 |
aaggttactagatcccctagtttttggtgagtaccctgctgagatgcgctctattcttgggaaccggttgccaaagatctctacgaaggagaagagtctc |
33496422 |
T |
 |
| Q |
177 |
ctaagaggcagcctggacttcattggcatcaataactacggggctctctatgccaaggaatgctacctctcaacttgccctctcgaagcagctcgtccaa |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||||| ||||| || ||||| ||||||||||||| |
|
|
| T |
33496421 |
ctaagaggcagcctggacttcattggcatcaataactatggagctctctatgccaaggattgctacctctctacttgtccactcgaggcagctcgtccaa |
33496322 |
T |
 |
| Q |
277 |
taaaaggctttttgcaaacaacaggaatgagagatggcattccaattggtgatcaggtactcatatgtagtccaactgttcttgtcattgtgttatatgg |
376 |
Q |
| |
|
||| ||||||| || ||||||| || |||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
33496321 |
taagaggctttctggaaacaactgggatgagagatggcattccaattggtgatcaggtactcgtatgtagtccaactgctcttgtcattatgttatatgg |
33496222 |
T |
 |
| Q |
377 |
t |
377 |
Q |
| |
|
| |
|
|
| T |
33496221 |
t |
33496221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 377 - 432
Target Start/End: Complemental strand, 19536508 - 19536453
Alignment:
| Q |
377 |
tctatgaagcacggatacggacaccggacacgacgcggatactgacacaccgacac |
432 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||| | |||||| ||||||| |
|
|
| T |
19536508 |
tctatgaagcacagatacggacaccggacacgacacggacaatgacacgccgacac |
19536453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 378 - 424
Target Start/End: Complemental strand, 20539783 - 20539737
Alignment:
| Q |
378 |
ctatgaagcacggatacggacaccggacacgacgcggatactgacac |
424 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||| |||||||| |
|
|
| T |
20539783 |
ctatgaagcacggatacggacactggacacgacacggacactgacac |
20539737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 378 - 435
Target Start/End: Original strand, 23717977 - 23718033
Alignment:
| Q |
378 |
ctatgaagcacggatacggacaccggacacgacgcggatactgacacaccgacaccgc |
435 |
Q |
| |
|
||||||||||||||||| ||||| ||||| ||| |||| ||||||||||||||||||| |
|
|
| T |
23717977 |
ctatgaagcacggatacagacac-ggacatgacacggacactgacacaccgacaccgc |
23718033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 378 - 435
Target Start/End: Original strand, 24105649 - 24105705
Alignment:
| Q |
378 |
ctatgaagcacggatacggacaccggacacgacgcggatactgacacaccgacaccgc |
435 |
Q |
| |
|
||||||||||||||||| ||||| ||||| ||| |||| ||||||||||||||||||| |
|
|
| T |
24105649 |
ctatgaagcacggatacagacac-ggacatgacacggacactgacacaccgacaccgc |
24105705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 379 - 410
Target Start/End: Complemental strand, 38117261 - 38117230
Alignment:
| Q |
379 |
tatgaagcacggatacggacaccggacacgac |
410 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38117261 |
tatgaagcacggatacggacaccggacacgac |
38117230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 377 - 407
Target Start/End: Original strand, 37419703 - 37419733
Alignment:
| Q |
377 |
tctatgaagcacggatacggacaccggacac |
407 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37419703 |
tctatgaagcacggatacggacaccggacac |
37419733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 388 - 433
Target Start/End: Complemental strand, 4142939 - 4142894
Alignment:
| Q |
388 |
cggatacggacaccggacacgacgcggatactgacacaccgacacc |
433 |
Q |
| |
|
||||||||||||||| ||||||| |||| |||||||| |||||||| |
|
|
| T |
4142939 |
cggatacggacaccgaacacgacccggacactgacacgccgacacc |
4142894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 379 - 432
Target Start/End: Original strand, 21624217 - 21624270
Alignment:
| Q |
379 |
tatgaagcacggatacggacaccggacacgacgcggatactgacacaccgacac |
432 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||| | || |||||||| ||||||| |
|
|
| T |
21624217 |
tatgaagcccggatacggacaccgaacacgacacagacactgacacgccgacac |
21624270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 4e-17; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 378 - 435
Target Start/End: Complemental strand, 19820503 - 19820446
Alignment:
| Q |
378 |
ctatgaagcacggatacggacaccggacacgacgcggatactgacacaccgacaccgc |
435 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||||||| |||||||||| |
|
|
| T |
19820503 |
ctatgaagcacggatacggacaccggacacgacacggacactgacactccgacaccgc |
19820446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 376 - 432
Target Start/End: Original strand, 22013362 - 22013418
Alignment:
| Q |
376 |
gtctatgaagcacggatacggacaccggacacgacgcggatactgacacaccgacac |
432 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |||||||| ||||||| |
|
|
| T |
22013362 |
gtctatgaagcacggatacggacaccggacacgacacggacactgacacgccgacac |
22013418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 378 - 432
Target Start/End: Complemental strand, 37328953 - 37328899
Alignment:
| Q |
378 |
ctatgaagcacggatacggacaccggacacgacgcggatactgacacaccgacac |
432 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||| |||| ||||| |||||||||| |
|
|
| T |
37328953 |
ctatgaagcacggacacggacaccgaacacgacacggacactgatacaccgacac |
37328899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 378 - 432
Target Start/End: Original strand, 42469171 - 42469225
Alignment:
| Q |
378 |
ctatgaagcacggatacggacaccggacacgacgcggatactgacacaccgacac |
432 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||| |||||| |||||| ||||||| |
|
|
| T |
42469171 |
ctatgaagcacggacacggacaccgaacacgacacggataatgacacgccgacac |
42469225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 378 - 410
Target Start/End: Original strand, 2436878 - 2436910
Alignment:
| Q |
378 |
ctatgaagcacggatacggacaccggacacgac |
410 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2436878 |
ctatgaagcacggatacggacaccggacacgac |
2436910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 7e-16; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 378 - 433
Target Start/End: Original strand, 27944991 - 27945046
Alignment:
| Q |
378 |
ctatgaagcacggatacggacaccggacacgacgcggatactgacacaccgacacc |
433 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||||||| |||||||| |
|
|
| T |
27944991 |
ctatgaagcacggatacggacaccggacacgacacggacactgacacgccgacacc |
27945046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 377 - 432
Target Start/End: Original strand, 24105628 - 24105682
Alignment:
| Q |
377 |
tctatgaagcacggatacggacaccggacacgacgcggatactgacacaccgacac |
432 |
Q |
| |
|
||||||||||||||||||||| | |||||||||| |||| |||||||| ||||||| |
|
|
| T |
24105628 |
tctatgaagcacggatacggata-cggacacgacacggacactgacacgccgacac |
24105682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 378 - 424
Target Start/End: Complemental strand, 43027578 - 43027532
Alignment:
| Q |
378 |
ctatgaagcacggatacggacaccggacacgacgcggatactgacac |
424 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||| |||| |||||||| |
|
|
| T |
43027578 |
ctatgaagcacggatgcggacactggacacgacacggacactgacac |
43027532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 378 - 410
Target Start/End: Complemental strand, 7328800 - 7328768
Alignment:
| Q |
378 |
ctatgaagcacggatacggacaccggacacgac |
410 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
7328800 |
ctatgaagcacggatacggacaccgaacacgac |
7328768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 378 - 430
Target Start/End: Original strand, 33994162 - 33994214
Alignment:
| Q |
378 |
ctatgaagcacggatacggacaccggacacgacgcggatactgacacaccgac |
430 |
Q |
| |
|
||||||||||||||||||||||| |||||||| || | |||||||| ||||| |
|
|
| T |
33994162 |
ctatgaagcacggatacggacacttgacacgacacgaacactgacacgccgac |
33994214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 379 - 435
Target Start/End: Original strand, 49107773 - 49107828
Alignment:
| Q |
379 |
tatgaagcacggatacggacaccggacacgacgcggatactgacacaccgacaccgc |
435 |
Q |
| |
|
|||||| |||||||||||||| ||||||||| |||| |||||||||||||||||| |
|
|
| T |
49107773 |
tatgaaacacggatacggacaa-ggacacgacacggactctgacacaccgacaccgc |
49107828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 8)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 378 - 432
Target Start/End: Complemental strand, 853968 - 853914
Alignment:
| Q |
378 |
ctatgaagcacggatacggacaccggacacgacgcggatactgacacaccgacac |
432 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||| ||||||| ||||||| |
|
|
| T |
853968 |
ctatgaatcacggatacggacaccggacacgacacggatgctgacacgccgacac |
853914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 378 - 432
Target Start/End: Complemental strand, 8365628 - 8365574
Alignment:
| Q |
378 |
ctatgaagcacggatacggacaccggacacgacgcggatactgacacaccgacac |
432 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||| |||||||| ||||||| |
|
|
| T |
8365628 |
ctatgaagcacggatacggacaccagacacgacacggacactgacacgccgacac |
8365574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 380 - 432
Target Start/End: Original strand, 12696277 - 12696328
Alignment:
| Q |
380 |
atgaagcacggatacggacaccggacacgacgcggatactgacacaccgacac |
432 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||| |||||||| ||||||| |
|
|
| T |
12696277 |
atgaagcacggatacggaca-cggacacgacacggacactgacacgccgacac |
12696328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 378 - 432
Target Start/End: Original strand, 3398569 - 3398623
Alignment:
| Q |
378 |
ctatgaagcacggatacggacaccggacacgacgcggatactgacacaccgacac |
432 |
Q |
| |
|
|||||||||| ||||||||||| || ||||||| |||| |||||||| ||||||| |
|
|
| T |
3398569 |
ctatgaagcatggatacggacatcgaacacgacacggacactgacacgccgacac |
3398623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 378 - 432
Target Start/End: Original strand, 6389693 - 6389747
Alignment:
| Q |
378 |
ctatgaagcacggatacggacaccggacacgacgcggatactgacacaccgacac |
432 |
Q |
| |
|
|||||||||||||| || ||||||||||||||| |||| ||| |||| ||||||| |
|
|
| T |
6389693 |
ctatgaagcacggacacagacaccggacacgacacggacactcacacgccgacac |
6389747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 378 - 432
Target Start/End: Original strand, 4877890 - 4877946
Alignment:
| Q |
378 |
ctatgaagcacggatacggacac--cggacacgacgcggatactgacacaccgacac |
432 |
Q |
| |
|
||||||||||| ||||||||||| || ||||||| |||||| |||||||||||||| |
|
|
| T |
4877890 |
ctatgaagcacagatacggacacgccgaacacgacacggatagtgacacaccgacac |
4877946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 377 - 410
Target Start/End: Original strand, 10649277 - 10649310
Alignment:
| Q |
377 |
tctatgaagcacggatacggacaccggacacgac |
410 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
10649277 |
tctatgaagcacggatacggacaccggatacgac |
10649310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 387 - 435
Target Start/End: Original strand, 9027137 - 9027185
Alignment:
| Q |
387 |
acggatacggacaccggacacgacgcggatactgacacaccgacaccgc |
435 |
Q |
| |
|
||||| |||||| ||||||||||| |||| |||||||| |||||||||| |
|
|
| T |
9027137 |
acggacacggactccggacacgacacggacactgacacgccgacaccgc |
9027185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000004; HSPs: 8)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 377 - 424
Target Start/End: Complemental strand, 39130877 - 39130830
Alignment:
| Q |
377 |
tctatgaagcacggatacggacaccggacacgacgcggatactgacac |
424 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
39130877 |
tctatgaagcacggatacggacaccggacacgacatggatattgacac |
39130830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 378 - 424
Target Start/End: Complemental strand, 5927449 - 5927403
Alignment:
| Q |
378 |
ctatgaagcacggatacggacaccggacacgacgcggatactgacac |
424 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
5927449 |
ctattaagcacggatacggacaccggacacgacacggacactgacac |
5927403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 377 - 433
Target Start/End: Complemental strand, 9630690 - 9630634
Alignment:
| Q |
377 |
tctatgaagcacggatacggacaccggacacgacgcggatactgacacaccgacacc |
433 |
Q |
| |
|
|||||||||||||||||| |||||| ||||| || |||| |||||||| |||||||| |
|
|
| T |
9630690 |
tctatgaagcacggatacagacaccagacacaacacggacactgacacgccgacacc |
9630634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 378 - 410
Target Start/End: Complemental strand, 35702691 - 35702659
Alignment:
| Q |
378 |
ctatgaagcacggatacggacaccggacacgac |
410 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
35702691 |
ctatgaagcacggatacggacaccggacacgac |
35702659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 432
Target Start/End: Original strand, 40917716 - 40917755
Alignment:
| Q |
393 |
acggacaccggacacgacgcggatactgacacaccgacac |
432 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
40917716 |
acggacaccggacacgacacggatactgacacgccgacac |
40917755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Complemental strand, 48040560 - 48040517
Alignment:
| Q |
389 |
ggatacggacaccggacacgacgcggatactgacacaccgacac |
432 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||| ||||||| |
|
|
| T |
48040560 |
ggatacggacaccggacacgacacggacactgacacgccgacac |
48040517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 394 - 435
Target Start/End: Complemental strand, 398858 - 398817
Alignment:
| Q |
394 |
cggacaccggacacgacgcggatactgacacaccgacaccgc |
435 |
Q |
| |
|
||||||||||||||||| |||| |||||||| |||||||||| |
|
|
| T |
398858 |
cggacaccggacacgacacggacactgacacgccgacaccgc |
398817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 395 - 427
Target Start/End: Complemental strand, 18190192 - 18190160
Alignment:
| Q |
395 |
ggacaccggacacgacgcggatactgacacacc |
427 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
18190192 |
ggacaccggacacgacacggatactgacacacc |
18190160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0306 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0306
Description:
Target: scaffold0306; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 378 - 432
Target Start/End: Original strand, 13350 - 13404
Alignment:
| Q |
378 |
ctatgaagcacggatacggacaccggacacgacgcggatactgacacaccgacac |
432 |
Q |
| |
|
||||||||||||||||||||||||||| | ||| |||| |||||||| ||||||| |
|
|
| T |
13350 |
ctatgaagcacggatacggacaccggagatgacacggacactgacacgccgacac |
13404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 378 - 432
Target Start/End: Original strand, 20122 - 20176
Alignment:
| Q |
378 |
ctatgaagcacggatacggacaccggacacgacgcggatactgacacaccgacac |
432 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||| | |||||| ||||||| |
|
|
| T |
20122 |
ctatgaagcacagatacggacaccggacacgacacggacaatgacacgccgacac |
20176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0152 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0152
Description:
Target: scaffold0152; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 378 - 432
Target Start/End: Complemental strand, 21977 - 21923
Alignment:
| Q |
378 |
ctatgaagcacggatacggacaccggacacgacgcggatactgacacaccgacac |
432 |
Q |
| |
|
||||||||||||||||||||||||||| | ||| |||| |||||||| ||||||| |
|
|
| T |
21977 |
ctatgaagcacggatacggacaccggagatgacacggacactgacacgccgacac |
21923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000002; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 378 - 420
Target Start/End: Original strand, 40332155 - 40332197
Alignment:
| Q |
378 |
ctatgaagcacggatacggacaccggacacgacgcggatactg |
420 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
40332155 |
ctatgaagcacggatacggacaccggacacgacacggacactg |
40332197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 378 - 425
Target Start/End: Original strand, 28642358 - 28642405
Alignment:
| Q |
378 |
ctatgaagcacggatacggacaccggacacgacgcggatactgacaca |
425 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||| | ||||||| |
|
|
| T |
28642358 |
ctatgaagcacggatacggacatcggacacgacacggacaatgacaca |
28642405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 377 - 407
Target Start/End: Original strand, 22595949 - 22595979
Alignment:
| Q |
377 |
tctatgaagcacggatacggacaccggacac |
407 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
22595949 |
tctatgaagcacggatacggacaccggacac |
22595979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 378 - 432
Target Start/End: Complemental strand, 25192456 - 25192402
Alignment:
| Q |
378 |
ctatgaagcacggatacggacaccggacacgacgcggatactgacacaccgacac |
432 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||| |||| |||||||| ||||||| |
|
|
| T |
25192456 |
ctatgaagcacgaatacggacatcggacacgatacggacactgacacgccgacac |
25192402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 378 - 435
Target Start/End: Complemental strand, 126457 - 126401
Alignment:
| Q |
378 |
ctatgaagcacggatacggacaccggacacgacgcggatactgacacaccgacaccgc |
435 |
Q |
| |
|
|||||||||||||||||| |||| |||||||| ||||||||||||| || ||||||| |
|
|
| T |
126457 |
ctatgaagcacggatacgcacac-ggacacgatacggatactgacacgccaacaccgc |
126401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 376 - 432
Target Start/End: Complemental strand, 13437075 - 13437019
Alignment:
| Q |
376 |
gtctatgaagcacggatacggacaccggacacgacgcggatactgacacaccgacac |
432 |
Q |
| |
|
|||||||||||||||| | |||||||||||| ||| ||| |||||||| ||||||| |
|
|
| T |
13437075 |
gtctatgaagcacggacatggacaccggacatgacatggacactgacacgccgacac |
13437019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000006; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 377 - 434
Target Start/End: Complemental strand, 4466710 - 4466653
Alignment:
| Q |
377 |
tctatgaagcacggatacggacaccggacacgacgcggatactgacacaccgacaccg |
434 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||| || | |||||||| ||||||||| |
|
|
| T |
4466710 |
tctatgaagcatggatacggacaccggacatgacacgaacactgacactccgacaccg |
4466653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 379 - 432
Target Start/End: Complemental strand, 8587129 - 8587076
Alignment:
| Q |
379 |
tatgaagcacggatacggacaccggacacgacgcggatactgacacaccgacac |
432 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||| |||| |||||||| ||||||| |
|
|
| T |
8587129 |
tatgaagcacagatacggacaccggacatgacacggacactgacacgccgacac |
8587076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 378 - 435
Target Start/End: Original strand, 8842280 - 8842337
Alignment:
| Q |
378 |
ctatgaagcacggatacggacaccggacacgacgcggatactgacacaccgacaccgc |
435 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||| | ||||| |||||||||| |
|
|
| T |
8842280 |
ctatgaagcacggatacggacaccggatacgacacggaaattgacatgccgacaccgc |
8842337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 378 - 432
Target Start/End: Original strand, 55401025 - 55401079
Alignment:
| Q |
378 |
ctatgaagcacggatacggacaccggacacgacgcggatactgacacaccgacac |
432 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||| |||| ||||| || ||||||| |
|
|
| T |
55401025 |
ctatgaagcacagatacggacaccggatacgacacggacactgatacgccgacac |
55401079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 377 - 410
Target Start/End: Original strand, 34910278 - 34910311
Alignment:
| Q |
377 |
tctatgaagcacggatacggacaccggacacgac |
410 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
34910278 |
tctatgaagcacggatacggacaccagacacgac |
34910311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 379 - 407
Target Start/End: Complemental strand, 8789652 - 8789624
Alignment:
| Q |
379 |
tatgaagcacggatacggacaccggacac |
407 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8789652 |
tatgaagcacggatacggacaccggacac |
8789624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0171 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0171
Description:
Target: scaffold0171; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 377 - 432
Target Start/End: Original strand, 23370 - 23424
Alignment:
| Q |
377 |
tctatgaagcacggatacggacaccggacacgacgcggatactgacacaccgacac |
432 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| | || |||||||| ||||||| |
|
|
| T |
23370 |
tctatgaagcacggatacggaca-cggacacgacacagacactgacacgccgacac |
23424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 381 - 432
Target Start/End: Complemental strand, 178925 - 178874
Alignment:
| Q |
381 |
tgaagcacggatacggacaccggacacgacgcggatactgacacaccgacac |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||| |||||||| ||||||| |
|
|
| T |
178925 |
tgaagcacggatattgacaccggacacgacacggacactgacacgccgacac |
178874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0361 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0361
Description:
Target: scaffold0361; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 379 - 408
Target Start/End: Original strand, 14498 - 14527
Alignment:
| Q |
379 |
tatgaagcacggatacggacaccggacacg |
408 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
14498 |
tatgaagcacggatacggacaccggacacg |
14527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0053 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0053
Description:
Target: scaffold0053; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 387 - 432
Target Start/End: Original strand, 8757 - 8802
Alignment:
| Q |
387 |
acggatacggacaccggacacgacgcggatactgacacaccgacac |
432 |
Q |
| |
|
||||| |||||||||||||||||| |||| |||||||| ||||||| |
|
|
| T |
8757 |
acggacacggacaccggacacgacacggacactgacacgccgacac |
8802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 377 - 410
Target Start/End: Original strand, 71678 - 71711
Alignment:
| Q |
377 |
tctatgaagcacggatacggacaccggacacgac |
410 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
71678 |
tctatgaagcacggatacggacatcggacacgac |
71711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000002; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 378 - 407
Target Start/End: Complemental strand, 7251730 - 7251701
Alignment:
| Q |
378 |
ctatgaagcacggatacggacaccggacac |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7251730 |
ctatgaagcacggatacggacaccggacac |
7251701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 379 - 424
Target Start/End: Original strand, 7670632 - 7670677
Alignment:
| Q |
379 |
tatgaagcacggatacggacaccggacacgacgcggatactgacac |
424 |
Q |
| |
|
||||||||||| ||| ||| ||||||||||||||||| |||||||| |
|
|
| T |
7670632 |
tatgaagcacgaatatggataccggacacgacgcggaaactgacac |
7670677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 377 - 406
Target Start/End: Original strand, 23700420 - 23700449
Alignment:
| Q |
377 |
tctatgaagcacggatacggacaccggaca |
406 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
23700420 |
tctatgaagcacggatacggacaccggaca |
23700449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 410
Target Start/End: Complemental strand, 482336 - 482308
Alignment:
| Q |
382 |
gaagcacggatacggacaccggacacgac |
410 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
482336 |
gaagcacggatacggacaccggacacgac |
482308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 378 - 410
Target Start/End: Complemental strand, 33464 - 33432
Alignment:
| Q |
378 |
ctatgaagcacggatacggacaccggacacgac |
410 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
33464 |
ctatgaagcacggataaggacaccggacacgac |
33432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University