View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2648_low_10 (Length: 269)
Name: NF2648_low_10
Description: NF2648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2648_low_10 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 269
Target Start/End: Original strand, 31692975 - 31693243
Alignment:
| Q |
1 |
ctagaaagagtattaaatcaaatggaagtatgactcctgctaaaagaatcaagtttcagaagtctgctgcttcacccgcaactcggcacattagtccttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31692975 |
ctagaaagagtattaaatcaaatggaagtatgactcctgctaaaagaatcaagtttcagaagtctgctgcttcacccgcaactcggcacattagtccttt |
31693074 |
T |
 |
| Q |
101 |
cactcttaagaagagaaagaaagttatcccaaatttggcaaagttattcagtagcaagaaaaacactatgcctaaagagtaaattcaatgccattgtttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
31693075 |
cactcttaagaagagaaagaaagttatcccgaatttggcaaagttattcagtagcaagaaaaacactatgcctaaagagtaaattcaacgtcattgtttt |
31693174 |
T |
 |
| Q |
201 |
aaatttcggtctacaatcgcacacactattagatataaagttagttatatcactactagctgatataac |
269 |
Q |
| |
|
||||| ||||||||||||||| ||| |||||||||||| |||||||| ||||||| |||||||||||| |
|
|
| T |
31693175 |
aaattccggtctacaatcgcatgcacaattagatataaaattagttatgtcactaccagctgatataac |
31693243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University