View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2648_low_11 (Length: 266)
Name: NF2648_low_11
Description: NF2648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2648_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 50456491 - 50456732
Alignment:
| Q |
1 |
tagatcatttatctcatttgcacacctactatatatacttcgatttcgtctctccgcttattctgcttctgattgaatacaaattacaaattacaaactc |
100 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
50456491 |
tagatcatttgtctcatttgcacgcctactatatatacttcgatttcgtctctccgcttattctgcttctgattgaataca-------aattacaaactc |
50456583 |
T |
 |
| Q |
101 |
tccgctcagccccagcgatctcaatctctcattctacatcttcccgttcaaatctcggtatgttttctgtttcttcttcatcctttgattagtatttcaa |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50456584 |
tctgctcagccccagcgatctcaatctctcattctacatcttcccgttcaaatctcggtatgttttctgtttcttcttcatcctttgattagtatttcaa |
50456683 |
T |
 |
| Q |
201 |
tttctttgcgttaatcttccggaaggggttctctaatcgaatattttgt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50456684 |
tttctttgcgttaatcttccggaaggggttctctaatcgaatattttgt |
50456732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University