View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2648_low_14 (Length: 236)
Name: NF2648_low_14
Description: NF2648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2648_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 16 - 220
Target Start/End: Complemental strand, 34922947 - 34922755
Alignment:
| Q |
16 |
tttctttcgcaatgtttggttatgggccgatacaaagaggagcttccactagaggattcgtttgttaacacaagttacacaccatctccgcctttacctc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
34922947 |
tttctttcgcaatgtttggttatgggccgatacaaagaggagcttccactagaggattcgtttgttaacacaagttgcacaccatctccgcatttacctc |
34922848 |
T |
|
| Q |
116 |
cacctcaatctccagctcagatgtctccatccctgtcatctccacctcagccaactccagccgatccgccggccaagaatgagatccatataaccctcac |
215 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34922847 |
ca------------gctcagatgtctccatccctgtcatctccacctcagccaactccagccgatccgccggccaagaatgagatccatataaccctcac |
34922760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University