View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2648_low_17 (Length: 213)
Name: NF2648_low_17
Description: NF2648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2648_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 1 - 197
Target Start/End: Original strand, 31693665 - 31693865
Alignment:
| Q |
1 |
gaatgcaaggatctcttagcacgagataatgagaatcact--cataaaaacctgtaccatgtgcagataagggctttattacttgtttcaaagcnnnnnn |
98 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||| |||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31693665 |
gaatgcaaggcactcttagcacgagataatgagaaccacttacataaaaattgataccatgtgcagataaggactttattacttgtttcaaaggaaaaaa |
31693764 |
T |
 |
| Q |
99 |
nn--gtttgatttgttctataaataagaaatttcctggaagtggcgacaatgaggctccttcatcaaggaaattgttgatctaatgcaatgacaaacaaa |
196 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31693765 |
agttgtttgatttgttctataaatgagaaatttcgtggaagtggagacaatgaggctccttcatcaaggaaattgttgatctaatgcaatgacaaacaaa |
31693864 |
T |
 |
| Q |
197 |
c |
197 |
Q |
| |
|
| |
|
|
| T |
31693865 |
c |
31693865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University