View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2651_high_13 (Length: 279)
Name: NF2651_high_13
Description: NF2651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2651_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 185 - 266
Target Start/End: Complemental strand, 11399349 - 11399268
Alignment:
| Q |
185 |
tttctctcattcttgtgttgagatagtcacatctgttgttatcattttaaaactataatttcaactttggattgttttgttg |
266 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| || | || |||||||||||||||||||| |||||||||||| |
|
|
| T |
11399349 |
tttctctcattctcgtgttgagatagtcacatctaaattttttgagttcaaactataatttcaactttgaattgttttgttg |
11399268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 114 - 151
Target Start/End: Complemental strand, 11399389 - 11399352
Alignment:
| Q |
114 |
tataatttcaacttcataactatttgaccgattgttat |
151 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11399389 |
tataatttcaacttcataactatttgactgattgttat |
11399352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University