View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2651_high_13 (Length: 279)

Name: NF2651_high_13
Description: NF2651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2651_high_13
NF2651_high_13
[»] chr5 (2 HSPs)
chr5 (185-266)||(11399268-11399349)
chr5 (114-151)||(11399352-11399389)


Alignment Details
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 185 - 266
Target Start/End: Complemental strand, 11399349 - 11399268
Alignment:
185 tttctctcattcttgtgttgagatagtcacatctgttgttatcattttaaaactataatttcaactttggattgttttgttg 266  Q
    ||||||||||||| ||||||||||||||||||||    || |    || |||||||||||||||||||| ||||||||||||    
11399349 tttctctcattctcgtgttgagatagtcacatctaaattttttgagttcaaactataatttcaactttgaattgttttgttg 11399268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 114 - 151
Target Start/End: Complemental strand, 11399389 - 11399352
Alignment:
114 tataatttcaacttcataactatttgaccgattgttat 151  Q
    |||||||||||||||||||||||||||| |||||||||    
11399389 tataatttcaacttcataactatttgactgattgttat 11399352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University