View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2651_high_9 (Length: 341)
Name: NF2651_high_9
Description: NF2651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2651_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 33 - 326
Target Start/End: Original strand, 7150470 - 7150760
Alignment:
| Q |
33 |
tagaacttttatatagataaggattcattctacgtattcaccattttattgattgtttgatggatatcgaacgctgatctcaatctaataat-accgatt |
131 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | ||||| |
|
|
| T |
7150470 |
tagaacttttgcatagataaggattcattctacgtattcaccattttattgattgtttgatggatatcgaacgctgatctcaatccaataatcatcgatt |
7150569 |
T |
 |
| Q |
132 |
aggtgaatgcatgagtctagggaacaagatccctattcccacacataatatataactgaaattgatatgttaatgaacatgggaaggatatattttaaat |
231 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7150570 |
aggtgaatgcatgaatctagggaacaagatccctattcccacacataata----actgaaattgatatgttaatgaacatgggaaggataaattttaaat |
7150665 |
T |
 |
| Q |
232 |
aagagtaaccaacataaaattgtcttttataccagtattgtttatttatctgaccgtacgtatgaaagatacaaaatatgtgacaccataataat |
326 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7150666 |
aagagtaactaacataaaattgtcttttatactagtattgtttatttatctgaccgaacgtatgaaagatacaaaatatgtgacaccataataat |
7150760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University