View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2651_low_23 (Length: 248)
Name: NF2651_low_23
Description: NF2651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2651_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 14 - 238
Target Start/End: Complemental strand, 7150309 - 7150086
Alignment:
| Q |
14 |
gaggtggttcaacccgccgtggttttaacttataaccgccgcaaatagtgttctttatggtgcatagaatcatagtcgtaatggaagagcannnnnnnna |
113 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| | |
|
|
| T |
7150309 |
gaggtggttcaaaccgccgtggctttaacttataacctccgcaaatagtgttctttatggtgcagagaatcatagtcgtaatggaagagcatttttttta |
7150210 |
T |
 |
| Q |
114 |
ccaaattaatggaatcgcataatgcttcattattttgatactttgtaaactaatagaataaaatggaaaatgatagcatctttactagtacaatgaaaaa |
213 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7150209 |
ccaa-ttaatggaatcgcataatgctccattattttgatactttgtaaactaatagaataaaatggaaaatgatagcatctttactagtacaatgaaaaa |
7150111 |
T |
 |
| Q |
214 |
catctcgaatagaatgcggcctttg |
238 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
7150110 |
catctcgaatagaatgcggcctttg |
7150086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University