View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2652_high_33 (Length: 319)
Name: NF2652_high_33
Description: NF2652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2652_high_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 50 - 272
Target Start/End: Complemental strand, 42462965 - 42462746
Alignment:
| Q |
50 |
attatatggtttaaaagtttgtcgtttaatatatgatatttcatgtgaaatttgtcgtttgataaaggacaaggaacattttgtgtgattgatgtacaag |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42462965 |
attatatggtttaaaagtttgtcgtttaatatatgatatttcatgtgaaatttgtcgtttgataaaggacaaggaacatt--gtgtgattgatgtacaag |
42462868 |
T |
|
| Q |
150 |
tgcaagtggaatgcaataggttgggagactcatcactcaatcaaaggggttttgattttttcaaaaccattttgagatttgcaccgttcttttatttgag |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
42462867 |
tgcaagtggaatgcaataggttgggagactcatcactcaatcaaaggggttttgattttttc-aacccattttgagatttgcaccgttcttttatttgag |
42462769 |
T |
|
| Q |
250 |
ggacaaatatggagtgtagataa |
272 |
Q |
| |
|
| ||||||||||||||||||||| |
|
|
| T |
42462768 |
gtacaaatatggagtgtagataa |
42462746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University