View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2652_high_41 (Length: 250)
Name: NF2652_high_41
Description: NF2652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2652_high_41 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 250
Target Start/End: Original strand, 32992479 - 32992711
Alignment:
| Q |
18 |
taaacaatttagaccttaacaaaattttaaaatacttcataaaattcaaaatcttctatcatagttgtctctctagaacaatttcatagactgattgact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32992479 |
taaacaatttagaccttaacaaaattttaaaatacttcataaaattcaaaatcttctatcatagttgtctctctagaacaatttcatagactgattgact |
32992578 |
T |
 |
| Q |
118 |
aagtcagaggactagtatgatcaaatattatataaaaattggactattttaaacttttgttaatttnnnnnnnntggattt-atgatcaatatgcaattg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
32992579 |
aagtcagaggactagtatgatcaaatattatataaaaattggattattttaaacttttgttaattt-aaaaaaatggatttgatgatcaatatgcaattg |
32992677 |
T |
 |
| Q |
217 |
ttgatgtaaatatatatactttacattgtaaccc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32992678 |
ttgatgtaaatatatatactttacattgtaaccc |
32992711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University