View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2652_high_53 (Length: 216)
Name: NF2652_high_53
Description: NF2652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2652_high_53 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 5 - 200
Target Start/End: Complemental strand, 48121590 - 48121395
Alignment:
| Q |
5 |
aagtctaacctttatttgatctcaatatccaagcaggtgtggaagaattatacatgccaagtttctccattggataattatggcacgactggttgcatgg |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48121590 |
aagtctaacctttatttgatctcaatatccaagcaggcgtggaagaattatacatgccaagtttctccattggataattatggtacgactggttgcatgg |
48121491 |
T |
 |
| Q |
105 |
ctccatacttgtacacacaacttgctactgctgtggaagtggcatatggtttgtatcactatggaccatttttggttgatttaatggattgtactt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48121490 |
ctccatacttgtacacacaacttgctactgctgtggaagtggcatatggtttgtatcactatggaccatttttggttgatttaatggattgtactt |
48121395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University