View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2652_low_31 (Length: 351)
Name: NF2652_low_31
Description: NF2652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2652_low_31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 13 - 137
Target Start/End: Complemental strand, 19853035 - 19852911
Alignment:
| Q |
13 |
attattctgatctgttaatgagtatagaagattctgttcttctaatatgagcttaggattgttttagccttctttcaagaagatcaacaacccctaaatc |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19853035 |
attatactgatctgttaatgagtatagaagattctgttcttctaatatgagcttaggattgttttagccttctttcaagaagatcaacaaccactaaatc |
19852936 |
T |
|
| Q |
113 |
caaattactttgttaaggctgaaat |
137 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
19852935 |
caaattactttgttaaggctgaaat |
19852911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 13 - 142
Target Start/End: Complemental strand, 4971992 - 4971863
Alignment:
| Q |
13 |
attattctgatctgttaatgagtatagaagattctgttcttctaatatgagcttaggattgttttagccttctttcaagaagatcaacaacccctaaatc |
112 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |||| || |||| |
|
|
| T |
4971992 |
attatactgatctgttaatgagtatagaacattctgttattctaatatgagcttaggattgttttagccttcaatcaagaagatcaataaccacttaatc |
4971893 |
T |
|
| Q |
113 |
caaattactttgttaaggctgaaattatat |
142 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| |
|
|
| T |
4971892 |
caaattacttggttaaggttgaaattatat |
4971863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University