View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2652_low_47 (Length: 250)
Name: NF2652_low_47
Description: NF2652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2652_low_47 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 12 - 250
Target Start/End: Original strand, 13453530 - 13453768
Alignment:
| Q |
12 |
tatactttgcggtgtgttttataatgattaatcctcgtaataataaaaataatatatttgtaataaatgatgagattaaaacccttatattaatatcgtt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| ||||| |
|
|
| T |
13453530 |
tatactttgcggtgtgttttataatgattaatcctcgtaataataaaaataatatatttgtaataaatgatgagattaaacccctcatattaatctcgtt |
13453629 |
T |
 |
| Q |
112 |
cttttgtttggatactgagttttagaaagatagaagtaatttgtaatggtggctagtttttaaacaaatcaagaaaataattgtaaaataattgatcttg |
211 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13453630 |
ctttggtttggataccgagttttagaaagatagaagtaatttgtaatgatggctagttttcaaacaaatcaagaaaatagttgtaaaataattgatcttg |
13453729 |
T |
 |
| Q |
212 |
atggaccaacaagattggttggatcggagagcaacgctt |
250 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13453730 |
atggaccaagaagattggttggatcggagagcaacgctt |
13453768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University