View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2652_low_50 (Length: 246)
Name: NF2652_low_50
Description: NF2652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2652_low_50 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 19 - 164
Target Start/End: Complemental strand, 16468142 - 16467997
Alignment:
| Q |
19 |
aaatagtgcaaccaactccattgaaatttgataattctagctataacttgtaaacccaattttgtgcacaacacttattcctttcctcaacaatttttgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| ||| ||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16468142 |
aaatagtgcaaccaactccattgaaatttgataattctagctgtaagttggaaacccaatttagtgtgcaacacttattcctttcctcaacaatttttgt |
16468043 |
T |
 |
| Q |
119 |
cacttaggttaaaatctagtaaaaataaaacggatagcagcaccag |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16468042 |
cacttaggttaaaatctagtaaaaataaaacggatagcagcaccag |
16467997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University