View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2652_low_51 (Length: 243)
Name: NF2652_low_51
Description: NF2652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2652_low_51 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 226
Target Start/End: Complemental strand, 15344734 - 15344527
Alignment:
| Q |
19 |
attcccacattgtgatgagaacgtggatatgcatcagtcttatgcagagctatgggaaagaacatgttttttgaaacgtgtcttcatcccttccttacta |
118 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
15344734 |
attcccccattgtgatgagaatgtggatatgcatcagtcttatgcagagctatgggaaagaacatgtgttttgaaacgtgtcttgatcccttccttacta |
15344635 |
T |
 |
| Q |
119 |
ttgtcctttttctgcctaggactcttttgtttcttttgctgcttgctagctttggaggagcaggccttaaccaagttttcttcaaaatatttgttgcttc |
218 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15344634 |
ttgtcctgtttctgcctaggactcttttgtttcttttgctgcttgctagctttggaggagcaggccttaaccaagttttcttcaaaatatttgttgcttc |
15344535 |
T |
 |
| Q |
219 |
catctgtg |
226 |
Q |
| |
|
|||||||| |
|
|
| T |
15344534 |
catctgtg |
15344527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University