View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2653_high_24 (Length: 217)
Name: NF2653_high_24
Description: NF2653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2653_high_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 12 - 199
Target Start/End: Complemental strand, 47678833 - 47678643
Alignment:
| Q |
12 |
gagcagagataattaatggcagaaatcccgaacaggaattatatgctattaagagcataatgtgcttatatttccctgttcagcatgca--gtgttgtt- |
108 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
47678833 |
gagcagacataattaatggcagaaatcccgaacaggaattatatgctattaagagcataatgtgcttatatttccctgttcagcatgcactgtgttgtta |
47678734 |
T |
 |
| Q |
109 |
nnnnnnntgagtgtttttacgagcacactttattttaacaatagtagtggaggacgttgatgacacgcgtttgatgttgttgcaatgtgaa |
199 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47678733 |
aaaaaaatgagtgtttttacgagcacactctattttaacaatagtagtggaggacgttgatgacacgcgtttgatgttgttgcaatgtgaa |
47678643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University