View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2653_low_15 (Length: 331)
Name: NF2653_low_15
Description: NF2653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2653_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 3 - 312
Target Start/End: Complemental strand, 39394081 - 39393772
Alignment:
| Q |
3 |
gaacaccttgctcgtgcaagcttcaatctgcaccgttcactctctcaagagcttaacggtacagaagcatacggttatcgatcactcaccgctctcagcc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39394081 |
gaacaccttgctcgtgcaagcttcaatctgcaccgttcactctctcaagagcttaacggtacagaagcatacggttatcgatcactcaccgctctcagcc |
39393982 |
T |
 |
| Q |
103 |
tcaccgtaactgaagaatcaaaaaccactgtttcttcctcctcgtcagctactttgccatcttggattgatgggccggcccatgggcctaaaacaattgg |
202 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39393981 |
tcaccgtagctgaagaatcaaaaaccactgtttcttcctcctcgtcagctactttgccatcttggattgatgggccgacccatgggcctaaaacaattgg |
39393882 |
T |
 |
| Q |
203 |
aacacacgaaactactgcgcaggtgcatccgcaactgtttacgcggacactgattgagaacgctgtggagaagtacggtgtgaaagttgtgattgggaaa |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39393881 |
aacacacgaaactactgcgcaggtgcatccgcaactgtttacgcggacactgattgagaacgctgtggagaagtacggtgtgaaagtcgtgattgggaaa |
39393782 |
T |
 |
| Q |
303 |
ttggagaggt |
312 |
Q |
| |
|
|||||||||| |
|
|
| T |
39393781 |
ttggagaggt |
39393772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University