View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2653_low_17 (Length: 307)
Name: NF2653_low_17
Description: NF2653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2653_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 118 - 299
Target Start/End: Complemental strand, 26001762 - 26001581
Alignment:
| Q |
118 |
aatgagaaatgatgagaaagggagagagaaagagaagtatttaaaggagagaatgtgtgctgtgacggtgggtcaaaatttggtggggacaaaattgatc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26001762 |
aatgagaaatgatgagaaagggagagagaaagagaagtatttaaaggagagaatgtgtgctgtgacggtgggtcaaaatttggtggggacaaaactgatc |
26001663 |
T |
 |
| Q |
218 |
tctatctttatttgggtgttgatgattttgtcaaagaagaaattgggtgtttatgattaaccttaatagaaaaaataccata |
299 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26001662 |
tctatctttaattgggtattgatgattttgtcaaagaagaaattgggtgtttatgattaaccttaatagaaaaaataccata |
26001581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 26001862 - 26001829
Alignment:
| Q |
18 |
agtagaatttgaaacagcaacggagcaagacatg |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
26001862 |
agtagaatttgaaacagcaacggagcaagacatg |
26001829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University