View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2653_low_24 (Length: 250)
Name: NF2653_low_24
Description: NF2653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2653_low_24 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 6 - 250
Target Start/End: Complemental strand, 47679153 - 47678911
Alignment:
| Q |
6 |
agcagcacagattgttgaccttctaaatagagatgcttccttnnnnnnntattattgatcgatgtgattattaatatttttgaaacttaaaattgtttgt |
105 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
47679153 |
agcatcacaggttgttgaccttctaaatagagatgcttccttaaaaaa-tattattgatcgatgtgattattaatatttttgaaacttaaaattgttttt |
47679055 |
T |
|
| Q |
106 |
attttgtgttttaacataaacgacaaccagaatactatacacgtgaaaatcccagttttataaccctacatctaacagcatggtcaaggaataaatagta |
205 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47679054 |
atttt-tgttttaacataaacaacaaccagaatactatacacgtgaaaatcccagttttataaccctacatctaacagcatggtcaaggaataaatagta |
47678956 |
T |
|
| Q |
206 |
ctggtacgtatttcactttgaataacaaaatgctggaagtttacc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47678955 |
ctggtacgtatttcactttgaataacaaaatgctggaagtttacc |
47678911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University