View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2653_low_26 (Length: 235)

Name: NF2653_low_26
Description: NF2653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2653_low_26
NF2653_low_26
[»] chr4 (1 HSPs)
chr4 (1-220)||(39394214-39394432)


Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 39394214 - 39394432
Alignment:
1 gccgatgactccgccgccgcaaacaaccactttcttggggtgatccatgggttgagaatcttgagattgaaccgatttgatagtggaaatgcgtattctg 100  Q
    ||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
39394214 gccgatgactccgccgccgcaaacaaccactctcttcgggtgatccatgggttgagaatcttgagattgaacagatttgatagtggaaatgcgtattctg 39394313  T
101 tttcgaggaattgccaccgctagattcatacagattagcatttttgaattggacacgtgtctctagaattcctttttcgttttcaactaatataaatatg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
39394314 tttcgaggaattgccaccgctagattcatacagattagcatttttgaattggacacgtgtctctagaattcctttttcgttttcaactaatat-aatatg 39394412  T
201 gtcattttgtggctggtaat 220  Q
    ||||||||||||||||||||    
39394413 gtcattttgtggctggtaat 39394432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University