View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2654_low_14 (Length: 242)
Name: NF2654_low_14
Description: NF2654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2654_low_14 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 17 - 242
Target Start/End: Original strand, 25682808 - 25683033
Alignment:
| Q |
17 |
atcaccattatttcttattcttttgaagtctatagactatatatgtaactttatattgtcannnnnnnnaatatattatactattcattcannnnnnnca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |
|
|
| T |
25682808 |
atcaccattatttcttattcttttgaagtctatagactatatatgtaactttatattgtcattttttttaatatattatactattcattcatttttttca |
25682907 |
T |
 |
| Q |
117 |
gtgtctacatgatatgaatatatgcaagtattgaaacttacattcatataatttttctcattaattttcctctctctgtgtctatatattcttcaattcc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25682908 |
gtgtctacatgatatgaatatatgcaagtattgaaacttacattcatttaattttgctcattaattttcctctctctgtgtctatatattcttcaattcc |
25683007 |
T |
 |
| Q |
217 |
ttttaggttcaaaaagagtgcatttt |
242 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
25683008 |
ttttaggttcaaaaagagtgcatttt |
25683033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University