View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2654_low_16 (Length: 233)
Name: NF2654_low_16
Description: NF2654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2654_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 19 - 140
Target Start/End: Original strand, 8845372 - 8845493
Alignment:
| Q |
19 |
actttccgggtcaccggagctccggtgaggaatttgggtcgggttgtcgtgtttccggcagacctgcttcgtgaaaatggccatatattgatattcaact |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8845372 |
actttccgggtcaccggagctccggtgaagaatttgggtcgggttgtcgtgtttccggcagacctgcttcgtgaaaatggccatatattgatattcaact |
8845471 |
T |
|
| Q |
119 |
ctgcagcagaatttgcaccgtt |
140 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
8845472 |
ctgcagcagaatttgcaccgtt |
8845493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University