View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2654_low_6 (Length: 325)
Name: NF2654_low_6
Description: NF2654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2654_low_6 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 14 - 325
Target Start/End: Original strand, 38932523 - 38932838
Alignment:
| Q |
14 |
agacaccaacacaacgtagctcagggtgattagcatcccatgtttcagtcagacctgcttctgactcaatgcggttgtcaggttccaatgcatcgatgct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38932523 |
agacaccaacacaacgtagctcagggtgattagcatcccatgtttcagtcagacctgcttctgactcaatgctgttgtcaggttccaatgcatcgatgct |
38932622 |
T |
 |
| Q |
114 |
atctagttggcacgactcaatttgatgacgtggtggaagctgtcgtgctgaacataagaagagtaacaaacaaagtgtgatcagaagagattttgtcttt |
213 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38932623 |
atctagttggcacgactcactttgatgacgtggtggaagctgtcgtgctgaacagaagaagagtaacaaacaaagtgtgatcagaagagattttgtcttt |
38932722 |
T |
 |
| Q |
214 |
gccatgatagctg---aactgtggagattgttatgtagtga-tttatttatagaaatgtagagaaggttaaacgatggacacgtaagtgaagcaatgtgg |
309 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38932723 |
gccatgctagctgaacaactgtggagattgttatgtagttattttatttatagaaatgtagagaaggttaaacgatggacacgtaagtgaagcaatgtgg |
38932822 |
T |
 |
| Q |
310 |
acattcttcaccatgc |
325 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
38932823 |
acattcttcaccatgc |
38932838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University