View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2654_low_7 (Length: 285)
Name: NF2654_low_7
Description: NF2654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2654_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 13 - 269
Target Start/End: Original strand, 301610 - 301866
Alignment:
| Q |
13 |
aatataaaattagctataggggatggtgagtttttcataatcatatctgaaatagtctgcagtttatatgtgtactttgtttgggggactgagcagtgat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
301610 |
aatataaaattagctataggggatggtgagtttttcataatcatatctgaaatagtctgcagtttatatgtgtactttgtttgggggactgagcagtgat |
301709 |
T |
|
| Q |
113 |
tgataaggatttgtcaataagttaggcttctttttcacttaatgtgtcacaggaacttttaatttttaaatatgttttcaaaatgagacctatgatttct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
301710 |
tgataaggatttgtcaataagttaggcttctttttcacttaatgtgtcacaggaacttttaatttttaaatatgttttcaaaattagacctatgatttct |
301809 |
T |
|
| Q |
213 |
cctgtttgtaattgactactttagacagggatcggattttgatataggacaattttg |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
301810 |
cctgtttgtaattgactactttagacagggatcggattttgatataggacaattttg |
301866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University