View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2655_high_27 (Length: 323)
Name: NF2655_high_27
Description: NF2655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2655_high_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 146 - 247
Target Start/End: Original strand, 33118382 - 33118483
Alignment:
| Q |
146 |
atgatcggtttggaaggaaaattacaatcctttatgcagatggactattctttgctggatcagtaatcatggctattgcacctaacccaacaattctaat |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33118382 |
atgatcggtttggaaggaaaattacaatcctttatgcagatggactattctttgctggatcagtaatcatggctattgcacctaacccaacaattctaat |
33118481 |
T |
|
| Q |
246 |
tg |
247 |
Q |
| |
|
|| |
|
|
| T |
33118482 |
tg |
33118483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 72; Significance: 1e-32; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 76 - 311
Target Start/End: Complemental strand, 21560746 - 21560511
Alignment:
| Q |
76 |
aaacaggaagcaatagtgagtacagcaattgctggtgcaattataggagcttcaggtggtggatggatgaatgatcggtttggaaggaaaattacaatcc |
175 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||| ||||| ||||| || |||| |||||||||||| || ||||| ||||||||||||| |||| |
|
|
| T |
21560746 |
aaacaggaagccatagtgagtacagcacttgctggagcaatcataggtgcatcagttggtggatggatcaacgatcgatttggaaggaaaaaagcaataa |
21560647 |
T |
|
| Q |
176 |
tttatgcagatggactattctttgctggatcagtaatcatggctattgcacctaacccaacaattctaattgttggtagagtttttgttggtcttggtgt |
275 |
Q |
| |
|
|| |||||||| ||| || || ||| ||||| || |||||| |||| || ||| | ||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
21560646 |
ttcttgcagatgcactctttttcattggctcagttattatggctgctgcaataaatccagctattctcattgttggtagagtctttgttggtcttggtgt |
21560547 |
T |
|
| Q |
276 |
tggaatggcatcaatggcatcccctctttatatctc |
311 |
Q |
| |
|
||||||||| |||||||| || ||| | |||||||| |
|
|
| T |
21560546 |
tggaatggcttcaatggcttctcctttatatatctc |
21560511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 77 - 161
Target Start/End: Complemental strand, 21493571 - 21493487
Alignment:
| Q |
77 |
aacaggaagcaatagtgagtacagcaattgctggtgcaattataggagcttcaggtggtggatggatgaatgatcggtttggaag |
161 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||| |||||| || ||| |||||||| |||||| |||||||||| |
|
|
| T |
21493571 |
aacaggaagccatagtgagtacagcaattgctggagcaattattggagctgcaattggaggatggatcaatgataggtttggaag |
21493487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 244 - 313
Target Start/End: Complemental strand, 21493404 - 21493335
Alignment:
| Q |
244 |
attgttggtagagtttttgttggtcttggtgttggaatggcatcaatggcatcccctctttatatctctg |
313 |
Q |
| |
|
||||||||| |||| ||||||||||||||||| || ||||| ||||||||||| ||| | || ||||||| |
|
|
| T |
21493404 |
attgttggtcgagtatttgttggtcttggtgtcgggatggcttcaatggcatctcctttgtacatctctg |
21493335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University