View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2655_low_20 (Length: 378)
Name: NF2655_low_20
Description: NF2655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2655_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 300
Target Start/End: Complemental strand, 35964510 - 35964205
Alignment:
| Q |
1 |
tcttcacatgtgtgaatgtgtttgttttctgctaaccaacacaacactgcctttgagaatctaggctcaattggcagtaccttttatggtaannnnnnnn |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35964510 |
tcttcacatgtttgaatgtgtttgttttctgctaaccaacacaacactgcctttgagaatctaggctcaattggcagtaccttttatggtattttttttt |
35964411 |
T |
 |
| Q |
101 |
nn------aatttaatttgattatataaagtttaggtgaattggatcacgatgatggcaaaagacggccttaatacttagatgagtgtcaatcgagataa |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
35964410 |
ttttttttaatttaatttgattatataaagtttaggtgaattagatcacgatgatggcaaaagacggccttaagacttagaagagtgtcaatcgagataa |
35964311 |
T |
 |
| Q |
195 |
ttatatattacctattaccgagtttctcaaatcgacagtagaatttgatctatgaatcataactcataagtttaatgtttgggggaaattaaatagatga |
294 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35964310 |
ttatatattacctattaacgagtttctcaaatcgacagtagaatttgatctatgaatcataactcataagtttaatgtttgggggaaattaaatagatga |
35964211 |
T |
 |
| Q |
295 |
acatag |
300 |
Q |
| |
|
|||||| |
|
|
| T |
35964210 |
acatag |
35964205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 35964708 - 35964621
Alignment:
| Q |
1 |
tcttcacatgtgtgaatgtgtttgtttt-ctgctaaccaacacaacactgcctttgagaatctaggctcaattggcagtaccttttatggtaa |
92 |
Q |
| |
|
||||||||||||||||||||||| |||| |||| ||||||||| |||||||||||||||| ||||| ||| |||||||||||||||||| |
|
|
| T |
35964708 |
tcttcacatgtgtgaatgtgtttttttttctgcaaaccaacac-----tgcctttgagaatctaagctcagttgacagtaccttttatggtaa |
35964621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 103 - 136
Target Start/End: Complemental strand, 35964603 - 35964570
Alignment:
| Q |
103 |
aatttaatttgattatataaagtttaggtgaatt |
136 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
35964603 |
aatttaatttgatcatataaagtttaggtgaatt |
35964570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University