View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2655_low_31 (Length: 323)

Name: NF2655_low_31
Description: NF2655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2655_low_31
NF2655_low_31
[»] chr5 (1 HSPs)
chr5 (146-247)||(33118382-33118483)
[»] chr2 (3 HSPs)
chr2 (76-311)||(21560511-21560746)
chr2 (77-161)||(21493487-21493571)
chr2 (244-313)||(21493335-21493404)


Alignment Details
Target: chr5 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 146 - 247
Target Start/End: Original strand, 33118382 - 33118483
Alignment:
146 atgatcggtttggaaggaaaattacaatcctttatgcagatggactattctttgctggatcagtaatcatggctattgcacctaacccaacaattctaat 245  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33118382 atgatcggtttggaaggaaaattacaatcctttatgcagatggactattctttgctggatcagtaatcatggctattgcacctaacccaacaattctaat 33118481  T
246 tg 247  Q
    ||    
33118482 tg 33118483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 72; Significance: 1e-32; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 76 - 311
Target Start/End: Complemental strand, 21560746 - 21560511
Alignment:
76 aaacaggaagcaatagtgagtacagcaattgctggtgcaattataggagcttcaggtggtggatggatgaatgatcggtttggaaggaaaattacaatcc 175  Q
    ||||||||||| ||||||||||||||| ||||||| ||||| ||||| || |||| |||||||||||| || ||||| |||||||||||||   ||||      
21560746 aaacaggaagccatagtgagtacagcacttgctggagcaatcataggtgcatcagttggtggatggatcaacgatcgatttggaaggaaaaaagcaataa 21560647  T
176 tttatgcagatggactattctttgctggatcagtaatcatggctattgcacctaacccaacaattctaattgttggtagagtttttgttggtcttggtgt 275  Q
    ||  |||||||| ||| || ||   ||| ||||| || ||||||  ||||   || ||| | ||||| |||||||||||||| |||||||||||||||||    
21560646 ttcttgcagatgcactctttttcattggctcagttattatggctgctgcaataaatccagctattctcattgttggtagagtctttgttggtcttggtgt 21560547  T
276 tggaatggcatcaatggcatcccctctttatatctc 311  Q
    ||||||||| |||||||| || ||| | ||||||||    
21560546 tggaatggcttcaatggcttctcctttatatatctc 21560511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 77 - 161
Target Start/End: Complemental strand, 21493571 - 21493487
Alignment:
77 aacaggaagcaatagtgagtacagcaattgctggtgcaattataggagcttcaggtggtggatggatgaatgatcggtttggaag 161  Q
    |||||||||| ||||||||||||||||||||||| |||||||| |||||| ||  ||| |||||||| |||||| ||||||||||    
21493571 aacaggaagccatagtgagtacagcaattgctggagcaattattggagctgcaattggaggatggatcaatgataggtttggaag 21493487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 244 - 313
Target Start/End: Complemental strand, 21493404 - 21493335
Alignment:
244 attgttggtagagtttttgttggtcttggtgttggaatggcatcaatggcatcccctctttatatctctg 313  Q
    ||||||||| |||| ||||||||||||||||| || ||||| ||||||||||| ||| | || |||||||    
21493404 attgttggtcgagtatttgttggtcttggtgtcgggatggcttcaatggcatctcctttgtacatctctg 21493335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University