View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2655_low_33 (Length: 316)
Name: NF2655_low_33
Description: NF2655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2655_low_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 16 - 306
Target Start/End: Complemental strand, 12607618 - 12607328
Alignment:
| Q |
16 |
acatatttggtcaaggattatgacataactttaacaaataaatcatcaaatatagtacaaactaaattacaataatttgcttagttgtcaattattatga |
115 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12607618 |
acatatttggtcaaggactatgacataactttaacaaataaatcatcaaatatagtacaaactaaattacaataatttgcttagttgtcaattattatga |
12607519 |
T |
|
| Q |
116 |
ccttggcgtacgaaaagcgaattgaaccccccaccaagcaagaagcagaagaaattagagttaagagggaacaagcaattgagaaactcaggcaaatggt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12607518 |
ccttggcgtacgaaaagcgaattgaaccccccaccaagccagaagcagaagaaattagagttaagagggaacaagcaattgagaaactcaggcaaatggt |
12607419 |
T |
|
| Q |
216 |
gcctaccacgtgcaccaataaatggtgtttgcttgcttgttttcataaagcactaatacaaattttaaggaactctactctttcatctcac |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12607418 |
gcctaccacgtgcaccaataaatggtgtttgcttgcttgttttcataaagcactaatacaaattttaaggaactctactttttcatctcac |
12607328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University