View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2655_low_36 (Length: 295)
Name: NF2655_low_36
Description: NF2655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2655_low_36 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 30 - 194
Target Start/End: Original strand, 32720347 - 32720511
Alignment:
| Q |
30 |
accaaatttagtgcaggtagtccagtacaatatgatcttaggcccgtgttaaatagagcctccataccttctaaacatacctccatctttttataaatac |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32720347 |
accaaatttagtgcaggtagtccagtacaatatgatcttaggcccgggttaaatagagcctccataccttctaaacatacctccatctttttataaatac |
32720446 |
T |
|
| Q |
130 |
acaccattgactcatttttaaagaaaatatcacgtattgtaaacttgcagttaattgtgatcatt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32720447 |
acaccattgactcatttttaaagaaaatatcacgtattgtaaacttgtagttaattgtgatcatt |
32720511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University