View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2655_low_49 (Length: 239)

Name: NF2655_low_49
Description: NF2655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2655_low_49
NF2655_low_49
[»] chr5 (1 HSPs)
chr5 (18-223)||(36158721-36158926)


Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 18 - 223
Target Start/End: Original strand, 36158721 - 36158926
Alignment:
18 aaatggacccaaaatcaggaaaaagtatagcagaggtgtgaatattcttttatagaattgggtgatttcattgagaatatattgatggagagaaatccaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36158721 aaatggacccaaaatcaggaaaaagtatagcagaggtgtgaatattcttttatagaattgggtgatttcattgagaatatattgatggagagaaatccaa 36158820  T
118 tggaaagaaaagaaagataagagatagaaaatgcagggaatatttacagcatgagagttagtaacagaacgaagaagttgcagcttctcatgcagtgctg 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36158821 tggaaagaaaagaaagataagagatagaaaatgcagggaatatttacagcatgagagttagtaacagaacgaagaagttgcagcttctcatgcagtgctg 36158920  T
218 ctctct 223  Q
    ||||||    
36158921 ctctct 36158926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University