View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2655_low_50 (Length: 238)
Name: NF2655_low_50
Description: NF2655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2655_low_50 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 17 - 145
Target Start/End: Complemental strand, 36490032 - 36489904
Alignment:
| Q |
17 |
agatagggtgatcttttatcgtattatctttttattatgtgttcggaaggaatagcgacactaataaaaatgcaaaaaggaatggtccgtggagtgaagg |
116 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36490032 |
agatagggtgagtttttatcgtattttctttttattatgtgttcggaaggaatggcgacactaataaaaatgcaaaaaggaatggtccgtggagtgaagg |
36489933 |
T |
|
| Q |
117 |
taatatgatgagttcctactatttgtcat |
145 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36489932 |
taatatgatgagttcctactatttgtcat |
36489904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 145 - 238
Target Start/End: Complemental strand, 36489810 - 36489717
Alignment:
| Q |
145 |
tatggacaaatgattaagaagtaaaaatatgagattttctttagtagaaatattcctccacgctctctaatattttacaagagccaaagtgcat |
238 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36489810 |
tatgggcaaatgattaagaagtaaaaatatgagattttctttagtagaaatattcctccacgctctctaatattttacaagtgccaaagtgcat |
36489717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University