View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2655_low_52 (Length: 226)
Name: NF2655_low_52
Description: NF2655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2655_low_52 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 3 - 226
Target Start/End: Complemental strand, 3989770 - 3989547
Alignment:
| Q |
3 |
tctgtactatatttacttatcacgcataagcacatacgcacttccgttttcttaccaaaagaatttagtcatgactcgtggatagtcattgtctatgtca |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3989770 |
tctgtactatatttacttatcacgcataagcacatacgcacttccgttttcttaccaaaagaatttagtcatgactcgtggatagtcattgtctatgtca |
3989671 |
T |
|
| Q |
103 |
gttaaagttcatctagaatttcactgccatcaatctccggtgtgaacagttatcctttaacgtgaaacaaatattttcttacatattagggcctgtcaca |
202 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3989670 |
gttaaagttcgtctagaatttcactgccatcaatctccggtatgaacagttatcctttaacgtgaaacaaatattttcttacatattagggcctgtcaca |
3989571 |
T |
|
| Q |
203 |
atcgccatgtttgaggcttcagac |
226 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
3989570 |
atcgccatgtttgaggcttcagac |
3989547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University