View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2656_low_7 (Length: 201)
Name: NF2656_low_7
Description: NF2656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2656_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 5e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 5e-64
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 44626541 - 44626724
Alignment:
| Q |
1 |
cctgataccatgtcctggaccacatgttatagcagttattttgattactgatgatccagcactaatagcaatgcaatcatcacctacaattaacatgatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44626541 |
cctgataccatgtcctggaccacatgttatagcagttattttgattactgatgatccagcactaatagcaatgcaatcatcacctacaattaacatgatt |
44626640 |
T |
 |
| Q |
101 |
agatagatacaaatcnnnnnnnnnnnnnnnnnngattgaaatgagttgaaaacattacctgttgcaatgaaagagttaagtacttga |
187 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44626641 |
agatagatacaaatc---aataataataatatagattgaaatgagttgaaaacattacctgttgcaatgaaagaattaagtacttga |
44626724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University