View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2657_high_3 (Length: 257)
Name: NF2657_high_3
Description: NF2657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2657_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 28884742 - 28884963
Alignment:
| Q |
1 |
taaccgcataacctatcttcactcgattacacataaacctcgtgagactgtctgtgagttatgtctgataaagatctaccccagttttttatgcaaactt |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
28884742 |
taaccgcataacctagcttcactcgattacacataaacctcgtgagactgt----gagttatgtctgataaagatctaccccagttttttatgcaaattt |
28884837 |
T |
|
| Q |
101 |
gggaagcttcagtgtggccatttatatcgctaccttgttacatatctcaagtaactgctttgcagtgggtatgcctttagcagcaagttcttcagtatct |
200 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28884838 |
gggaagcttcagta--gccatttatgtcgctaccttgttacatatctcaagtaactgctttgtagtgggtatgcctttagcagcaagttcttcagtatct |
28884935 |
T |
|
| Q |
201 |
cctcagacaaaatcaagcaccttgtttt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
28884936 |
cctcagacaaaatcaagcaccttgtttt |
28884963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 55 - 107
Target Start/End: Original strand, 28872959 - 28873011
Alignment:
| Q |
55 |
tgagttatgtctgataaagatctaccccagttttttatgcaaacttgggaagc |
107 |
Q |
| |
|
||||||||||| |||||||||| |||||| || ||||||||||| |||||||| |
|
|
| T |
28872959 |
tgagttatgtccgataaagatccaccccaattctttatgcaaacctgggaagc |
28873011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University