View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2657_low_4 (Length: 323)
Name: NF2657_low_4
Description: NF2657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2657_low_4 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 91 - 323
Target Start/End: Complemental strand, 7905341 - 7905109
Alignment:
| Q |
91 |
attacatggttcaaaaggttaagtgttctaaaaacctatgcaatttctttggagatttctggcttcgccgacatgttggcatgtttcagcattatgctag |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7905341 |
attacatggttcaaaaggttaagtgttctaaaaacctatgcaatttctttggagatttctggcttcgccgacatgttggcatgtttcagcattatgctag |
7905242 |
T |
|
| Q |
191 |
aagctatgagaaggtgacttggagtgcagtactttctgtgttcagtgaggaaagtttatcgaattgcggagtgaagagaaaactaaagaaaaaatgcaaa |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7905241 |
aagctatgagaaggtgacttggagtgcagtactttctgtgttcagtgaggaaagtttatcgaattgcagagtgaagagaaaactaaagaaaaaatgcaaa |
7905142 |
T |
|
| Q |
291 |
gattttagtactgcttttggtgaagtatacaaa |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
7905141 |
gattttagtactgcttttggtgaagtatacaaa |
7905109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University