View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2657_low_7 (Length: 265)
Name: NF2657_low_7
Description: NF2657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2657_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 12 - 201
Target Start/End: Complemental strand, 44695481 - 44695290
Alignment:
| Q |
12 |
acacttcttctttgttttgatttcaccttttaaatacattgatctcaaatctttttggagtctttgaggaa--attaattaatgttttgtacggcaggaa |
109 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44695481 |
acactttttctttgttttgatttcaccttttaaatacattgatctcaaatctttttggagtctttgaggaattattaattaatgttttgtacggcaggaa |
44695382 |
T |
 |
| Q |
110 |
tggtgaaactttgcctcaaatatcaaaggaatacataagagtaaagtaagtggtgcaagttagcatgcatggctgatcgatccatcatatca |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44695381 |
tggtgaaactttgcctcaaatatcaaaggaatacataagagtaaagtaagtggtgcaagttagcatgcatggctgatcgatccatcatatca |
44695290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University