View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2658_low_9 (Length: 251)
Name: NF2658_low_9
Description: NF2658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2658_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 40 - 223
Target Start/End: Complemental strand, 617601 - 617417
Alignment:
| Q |
40 |
aaattcattgtttcagttaccgatttgtctcttacaacttacagaggcataaaatctggtcaaaagcatgccctcaacacacagcactgctgcaatgtct |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
617601 |
aaattcattgtttcagttaccgatttgtctcttacaacttacagaggcatacaatctggtcaaaagcatgccctcaacacacagcactgctgcaatgtct |
617502 |
T |
|
| Q |
140 |
gctttgctttctgcttgcagactatat-ggggatacagatattggagaggctatagggaaacagatattagaattggaaccacat |
223 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
617501 |
gctttgctttctgcttgcagactatatgggggatacagatattggagaggctatagggaaacagatattagaattggaaccacat |
617417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 76 - 223
Target Start/End: Complemental strand, 15370518 - 15370371
Alignment:
| Q |
76 |
acttacagaggcataaaatctggtcaaaagcatgccctcaacacacagcactgctgcaatgtctgctttgctttctgcttgcagactatatggggataca |
175 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15370518 |
acttagagaggcatacaatctggtcaaaagcatgccgtcaacacacagctctgctgcaatgtctgctttgctttctgcttgcagactatatggggataca |
15370419 |
T |
|
| Q |
176 |
gatattggagaggctatagggaaacagatattagaattggaaccacat |
223 |
Q |
| |
|
|| ||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15370418 |
gagattggggaggctatagggaaacagatattaaaattggaaccacat |
15370371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University