View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2659_high_15 (Length: 252)
Name: NF2659_high_15
Description: NF2659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2659_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 16 - 239
Target Start/End: Original strand, 34851945 - 34852168
Alignment:
| Q |
16 |
gctttgacgattcttcctatgagattttgatagtttaagttccttgtgaagctggttgagcaagttgaaacccttgaaagtctttccaagaataacatca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34851945 |
gctttgacgattcttcctatgagattttgatagtttaagttccttgtgaagctggttgagcaagttgaaacccttgaaagtctttccaagaataacatca |
34852044 |
T |
 |
| Q |
116 |
tagccccctgaagcaccattgtcagcagagacaaaattggagaaaattttggcagctctggaaaacgaaatctctttagatgattcacaacgacgggtaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34852045 |
tagccccctgaagcaccattgtcagcagagacaaaattggagaaaattttggcagctctggaaagcgaaatctctttagatgattcacaacgacgggtaa |
34852144 |
T |
 |
| Q |
216 |
tcggcatcgattttggccaatttc |
239 |
Q |
| |
|
|||||||||||||| ||||||||| |
|
|
| T |
34852145 |
tcggcatcgattttcgccaatttc |
34852168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 125 - 205
Target Start/End: Complemental strand, 4297551 - 4297471
Alignment:
| Q |
125 |
gaagcaccattgtcagcagagacaaaattggagaaaattttggcagctctggaaaacgaaatctctttagatgattcacaa |
205 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||| |||||| | |||| | |||| || ||||||||||||||||||||| |
|
|
| T |
4297551 |
gaagcaccgttgtcagcagagacaaatttggagagaatttttgaagcttttgaaagtgatatctctttagatgattcacaa |
4297471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University