View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2659_low_10 (Length: 348)
Name: NF2659_low_10
Description: NF2659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2659_low_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 17 - 333
Target Start/End: Complemental strand, 35171842 - 35171526
Alignment:
| Q |
17 |
atgtatgtaggagagtatctagcagcagcaagactcaaaaacttacaaatagacatgtatatatgttagtatgtagaatattaatacctgtaattgatgc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35171842 |
atgtatgtaggagagtatctagcagcagcaagactcaaaaacttacaaatagacatgtatatatgttagtatgtagaatattaatacctgtaattgatgc |
35171743 |
T |
|
| Q |
117 |
atcatgttttcctgtttgatttcaatatctgaaagttgattccgaatacatgtcatttcatttgccctttgtaaacaacattgatgtataatttggggac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35171742 |
atcatgttttcctgtttgatttcaatatctgaaagttgattccgaatacaagtcatttcatttgccctttgtaaacaacattgatgtgtaatttggggac |
35171643 |
T |
|
| Q |
217 |
ttgattcggtgactgtagaatcagaacttttaggatcctgcatctttatggagtacatttgttcattgcagcttattccttcacctaaccgttggcttct |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35171642 |
ttgattcggtgactgtagaatcagaacttttaggatcctgcatctttatggagtcaatttgttcattgcagcttattccttcatctaaccgttggcttct |
35171543 |
T |
|
| Q |
317 |
cccatttggcttctgtg |
333 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
35171542 |
cccatttggcttctgtg |
35171526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University